Advertisement
Advertisement

The Internet Journal of Cardiovascular Research ISSN: 1540-2592


Analysis of nsSNP rs1468384 of NPC1L1 and its association with plasma cholesterol levels in general population


Praveen P. Balgir Head & Professor, Department of Biotechnology, Punjabi University Patiala India
Divya Khanna SRF, CSIR Department of Biotechnology, Punjabi University Patiala India
Gurlovleen Kaur SRF Department of Biotechnology, Punjabi University Patiala India

Citation:  P.P. Balgir, D. Khanna, G. Kaur: Analysis of nsSNP rs1468384 of NPC1L1 and its association with plasma cholesterol levels in general population. The Internet Journal of Cardiovascular Research. 2009 Volume 6 Number 2

Keywords:  NPC1L1, M510I, SNP, INFLUX TRANSPORTER, PCR-RFLP.

Abstract

Niemann-Pick C1–like 1 (NPC1L1) protein, a newly identified sterol influx transporter, located at the apical membrane of the enterocyte, which may actively facilitate the uptake of cholesterol by promoting the passage of sterols across the brush border membrane of the enterocyte. It effects intestinal cholesterol absorption and intracellular transport and as such is an integral part of complex process of cholesterol homeostasis. The study of population data for the distribution of these SNPs of NPC1L1 has lead to the identification of six nsSNPs (non-synonymous single nucleotide polymorphism). The in vitro analysis using the software MuPro and StructureSNP shows that nsSNP M510I (rs1468384), which involves A→G base pair change leads to decrease in the stability of the protein. A reproducible and a cost-effective PCR-RFLP based assay was developed to screen for the SNP distribution amongst the North Western Indian population as a test case. This SNP has been studied in Caucasian, Asian and African American populations. Till date, no data is available on Indian population. The allele distribution in Indian Population differs significantly from that of other populations. Moreover on investigating the effect of this nsSNP on the plasma lipid levels in the general population we found a profound association of this nsSNP with higher ranges of plasma lipid levels.


Introduction

Niemann-Pick C1–like 1 (NPC1L1) protein, a newly identified sterol influx transporter, located at the apical membrane of the enterocyte, which may actively facilitate the uptake of cholesterol by promoting the passage of sterols across the brush border membrane of the enterocyte (1,2). The protein has been characterized by the presence of a signal peptide, 13 putative transmembrane regions, a conserved NPC1 domain and a sterol sensing domain (SSD). Although expressed within several tissues in the body, the expression is predominant in liver and small intestine (3, 4, and 5). In rodents, NPC1L1 is highly expressed on the surface of jejunal absorptive cells whereas in humans the expression is more in the hepatoma cells in the liver (6). The protein plays a key role in cholesterol uptake and intracellular cholesterol trafficking from the plasma membrane to the endoplasmic reticulum (7). A fact further strengthened by the observation of Gracio-Calvo et al., 2005 (8) that the protein was the direct molecular target of ezetimibe, a drug that inhibits cholesterol absorption. Recently Temel et al., 2007 (9) have suggested the presence of NPC1L1 on the canalicular membrane of hepatocytes which may modulate biliary cholesterol excretion. Thus this protein is actively involved in the cholesterol homeostasis pathway (10, 11).

Single nucleotide polymorphisms (SNPs), together with copy number variation, are the primary source of variability in the human genome. As amino acid substitutions currently account for approximately half of the known gene lesions responsible for human inherited disease, study of nsSNPs are important in delineating the etiology of many such disorders (12, 13). These SNPs may lead to changes in protein confirmation and may be associated with altered response to drug treatment, susceptibility to disease, and other phenotypic variations (14). The study of population data for the distribution of NPC1L1 has lead to the identification of six nsSNPs (non-synonymous single nucleotide polymorphism). Among the 6 identified nsSNPs, M510I (rs1438384) shows decrease in the stability of the protein as analysed in silico by MuPro (15) and StructureSNP (16) softwares. The M510I polymorphism is the result of a nucleotide change G to A at position 2993 of the cDNA sequence in exon 2, and it results in the substitution of isoleucine for methionine at amino acid 510 of the NPC1L1 protein. The SNP has already been studied in Caucasian, Asian and African American populations by sequencing as given in NCBI database. Till date, no data is available on Indian population. Thus, a reproducible and cost-effective PCR-RFLP based assay was developed to study the distribution of this SNP as well as its association with plasma lipid levels and further implication in development of atherosclerosis.

Material and Methods

High molecular weight genomic DNA was extracted from 3.0 ml of the blood samples collected from 150 normal healthy individuals in the age group 20-50 years with informed consent. The DNA was isolated by methodology as given by Lahiri et al., 1991 (17).

Primer designing

The primers for the PCR were designed by using the software GENE RUNNER Version 3.05. The selected primers are listed in the table 1.


                     Table 1. The Primer Pair selected by GENE RUNNER Version 3.05

Table 1. The Primer Pair selected by GENE RUNNER Version 3.05

PCR Reaction Optimization

The PCR reaction was optimized for 200 ng of DNA. The primer pair selected was 5’TATGGTCGCCCGAAGCACAG3’& 3’GATGGCCACGCACAAACCTG5’ and were designed using GENERUNNER version 3.05 (Hastings Software Inc. Hastings, NY, USA, http://www.generunner.com). A 25μL PCR mixture was optimized containing 1.5 mM MgC12, 0.4μM of each primer (Imperial Genetics, USA), 200μM of each deoxynucleotide triphosphate (Fermentas, USA), 10% Glycerol (Sigma, USA), 1.0 U of Taq polymerase (Intron Technologies, Germany), and buffer concentration of 50 mM KC1 and 10 mM Tris- HC1, pH 8.4. A two step PCR cycles were optimized, with first step with initial denaturation at 95°C followed by 30 cycles of denaturation at 95°C for 1min, annealing at 61.5°C for 1min and extension at 72°C for 1.30 min. This is followed by a final extension (72°C, 5 minutes) and a 4°C hold. The annealing temperature (Ta) was optimized at 61.5°C.The temperature was calculated using the formula: Ta = 0.3* Tm primer + 0.7 * Tm product – 14.9., where Tm product = 83°C, and it was Ta = 60.5 °C (±1 °C).The PCR product of size 437 bp was obtained and stored at 4 ºC.

RFLP Analysis

Five units of BccI (New Englands Biolab) was added to 15 μL of PCR product and incubated overnight at 37°C. Restriction Enzyme BccI with the recognition site 5’CCATC (N 4) ↓...3’was selected from New England Biolab website, http.//www.neb.com/. All of the digested products were electrophoresed on 10% Polyacrylamide Gel Electrophoresis. The gel was run at 150V for 3 hours. The gel was visualized by Silver Staining (18).

Measurement of plasma lipids

Lipid profiles that were studied included total serum cholesterol, serum triglycerides (TG), high density lipoprotein (HDL) and low density lipoprotein (LDL). All these variables were measured by kit procedures supplied by Ozone Biomedics (Cholesterol estimation kit, New Delhi). LDL-c was estimated using Friedewald’s formula (19).

Results and Discussion

An efficient PCR reaction not only generates product of requisite size but also should utilize the primers completely. Thus a minimal difference in their melting temperatures (Tm) is favourable (20) and in the case of all primer pairs selected as per Table No.1 the Tm difference is of 1ºC. Both primers and target sequence affect this efficiency. Moreover as nucleic acids have tendency to fold into conformations (secondary structures), which have high negative free energy at room temperatures. Thus the stability of these template secondary structures depends largely on their free energy and melting temperatures(Tm) and is extremely important for designing primers (21, 22, & 23). Keeping these guidelines in mind, the four primer pairs were scrutinized. The second primer pair was finally selected as it had least number of secondary structures (table 2); with no hair pin loop, no bulge loops and just 1 internal loop in sense strand not at the temperature range during PCR. Although dimers were observed both in sense and antisense primer strand but at temperatures far below the experimental temperature range. Moreover the primers so designed were unique i.e. they targeted and amplified only the specific gene in the genomic DNA as given by the Blast (24) (Table No.1). The second primer pair gave minimum and unique hits.


                  Table 2: Structural Analysis of the primer pair selected

Table 2: Structural Analysis of the primer pair selected

The PCR reaction was set at three different annealing temperatures i.e.59.5°C, 60.5 °C and 61.5 °C. The results are shown in the figure 1. The annealing temperature of 61.5 °C proved to be the most stringent, giving optimum results at which no spurious amplification were observed in the PCR products as compared to other temperatures (Figure 1).


                  Figure 1: A 1.5% Agarose gel depicting NPC1L1 PCR product of size 437 bp at different annealing temperatures (Lane A- 61.5°C, Lane B- 60.5° , Lane C- 59.5°C & Lane M -Marker).

Figure 1: A 1.5% Agarose gel depicting NPC1L1 PCR product of size 437 bp at different annealing temperatures (Lane A- 61.5°C, Lane B- 60.5° , Lane C- 59.5°C & Lane M -Marker).

The optimization of amount of Taq polymerase and number of PCR cycles was then carried out. The amount of Taq polymerase was tested in the range 0.25 to2 U per reaction. As little as 0.5 U enzymes could be used without a decrease in the yield of PCR product (data not shown). PCR was performed for 25, 30 and 35, cycles, including the initial cycle. The PCR products could be detected after 25 cycles, maximal PCR product was obtained with 30 cycles of PCR amplification without the production of nonspecific amplification and complete utilization of primers (data not shown). The product was purified and sequenced to confirm the region amplified. The figure 2 depicts the sequence of the PCR product as obtained from Bangalore Genei and viewed in CHROMAS.


                  Figure 2: Sequence of PCR product amplified as obtained from Bangalore Genei and viewed in CHROMAS.

Figure 2: Sequence of PCR product amplified as obtained from Bangalore Genei and viewed in CHROMAS.

The amplified product was subjected to digestion by Bcc1 restriction enzyme. After digestion of the 437 bp fragment obtained by PCR, the three possible genotypes were distinguishable: homozygous GG (437 bp), heterozygous GA (437, 278 and 159 bp), and homozygous AA (278 and 159 bp).The table 3 and the gel picture (figure 3) below depicts the band pattern for different genotypes.


                  Table 3. The Band Pattern obtained after digestion with Bcc1 enzyme

Table 3. The Band Pattern obtained after digestion with Bcc1 enzyme


                  Figure 3. Determination of the M510I genotype by PCR amplification and restriction analysis.

Figure 3. Determination of the M510I genotype by PCR amplification and restriction analysis.

The genotype frequency distribution for the M510I polymorphism is shown in table 3 with heterozygous AG having maximum percentage of 43.3%, followed by homozygous AA (32.6%) and GG (24%). The difference in allele frequency distribution between different population groups was observed. The “G”allele present in Indian Population showed the least frequency of 0.46 (95% CI) and Caucasian Population samples the maximum at 1.000. For “A” allele it is 0.54 (95% CI) in Indian Population (table 5). The data was then analyzed for χ2 value to study difference in allele distribution amongst the Indian population and other populations of the world studied so far (table 6). Statistically, highly significant differences were observed on comparison with these populations. Even the population labelled as Asian on closer scrutiny was found to be a mixed group constituted of populations of mongoloid origin like the Chinese, Malaysians etc. This group also showed the allele distribution to be highly significantly different from the North Western Indian Population under study.


                  Table 4. NPC1L1 Genotype Distribution amongst North Western Indian population.

Table 4. NPC1L1 Genotype Distribution amongst North Western Indian population.


                  Table 5. NPC1L1 allele frequency distribution amongst different populations

Table 5. NPC1L1 allele frequency distribution amongst different populations


                  Table 6. Comparison between North Western Indian population and other populations of the world.

Table 6. Comparison between North Western Indian population and other populations of the world.

Contribution of the rs1468384 NPC1L1 gene variants on plasma Lipid levels

The individuals under study were divided into two group’s i.e. lower plasma lipid group and higher plasma lipid group. The characteristics of the individuals in the two groups are shown in the table 7, below. The LDLc levels of the individuals in the low lipid group ranged from 10-149mg/dl (mean ± S.D, 136.96 ± 2.396) and those in high lipid group ranged from 150-300 mg/dl (mean ± S.D, 161.30±2.44). HDLc levels were significantly higher in low lipid group ranging between 40-65 mg/dl (mean ± S.D, 58.51±1.32) and lower in higher plasma lipid group (31.24±1.079). The Lipid levels among two groups were compared by Student’s t-test which depicted significant probability values.


                     Table 7. Characteristics of individuals in the low plasma lipid and high plasma lipid groups.

Table 7. Characteristics of individuals in the low plasma lipid and high plasma lipid groups.

Statistical analysis was also carried out in order to determine whether this non synonymous sequence variant (rs1468384) in the NPC1L1 gene affect plasma lipid levels. Deviations in the distribution of genetic variant in either the low plasma lipid group or the high plasma lipid group were assessed by Chi square test. The table 8 shows that this nsSNP is significantly associated with the plasma lipid levels.


                     Table 8. Comparison of Allele frequency distribution amongst lower and higher plasma lipid groups.

Table 8. Comparison of Allele frequency distribution amongst lower and higher plasma lipid groups.

The above analysis depicts that this nsSNP has a significant association with plasma lipid levels. Thus it can be hypothesized that this mutation has an implication on the function of NPC1L1gene as cholesterol transporter and may affect its role in the intestinal uptake of cholesterol. This study can provide us a lead to determine the affect of this nsSNP on cholesterol homeostasis pathway and its association with some complex disease states as atherosclerosis resulting due to any interruption in the cholesterol pathway.

Acknowledgement

Ms. Divya Khanna is thankful to Council of Scientific and Industrial Research, New Delhi for award no. CSIR SRF F.No. 9/140(138)/2004 EMR-1 of Senior Research Fellowship.

References

1. Lammert F and Wang DQH. New Insights into the Genetic Regulation of Intestinal Cholesterol Absorption. Gastroenterology; 2005; 129:718–734.
2. Yu L et al. Cholesterol-regulated translocation of NPC1L1 to the cell surface facilitates free cholesterol uptake. J Biol Chem 2006; 281: 6616–6624.
3. Altmann SW, Davis HR Jr, Zhu LJ, Yao X, Hoos LM, Tetzloff G et al. Niemann-Pick C1 Like 1 protein is critical for intestinal cholesterol absorption, Science 2004; 303:1,201–1,204.
4. Davies JP, Levy B, Ioannou YA. Evidence for a Niemann-Pick C (NPC) gene family: identification and characterization of NPC1L1. Genomics 2000; 65: 137–145.
5. Davies JP, Scott C, Oishi K, Liapis A, Ioannou YA. Inactivation of NPC1L1 causes multiple lipid transport defects and protects against diet-induced hypercholesterolemia. J Biol Chem 2005; 280: 12710–12720.
6. Van Heek M, Farley C, Compton DS, Hoos L, Alton KB, Sybertz EJ, Davis HR, Jr. Comparison of the activity and disposition of the novel cholesterol absorption inhibitor, SCH58235, and its glucuronide, SCH60663. Br J Pharmacol. 2000; 129:1748 –1754.
7. Field FK, Watt K, and Mathur SN. Ezetimibe interfere with cholesterol trafficking from the plasma membrane to the endoplasmic reticulum in CaCo-2 cells. Journal of Lipid Research 2007; Vol. 48: 1735-1745.
8. Garcia-Calvo M, Lisnock J, Bull HG, Hawes BE, Burnett DA, Braun MP, Crona JH, Davis HR, Jr., Dean DC, Detmers PA, Graziano MP, Hughes M, Macintyre DE, Ogawa A, O’Neill KA, Iyer SP, Shevell DE, Smith MM, Tang YS, Makarewicz AM, Ujjainwalla F, Altmann SW, Chapman KT, Thornberry NA. The target of ezetimibe is Niemann-Pick C1-Like 1 (NPC1L1). Proc Natl Acad Sci U S A. 2005; 102: 8132–8137.
9. Temel RE, Tang W, Ma Y, Rudel LL, Willingham CM, Ioannou AY. Hepatic Niemann-Pick C1–like 1 regulates biliary cholesterol concentration and is a target of ezetimibe. Journal of Clinical Investigation 2007; 117:1968-1978.
10. Sane AT, Sinnett D, Delvin M, Bendayan V, Marcil D, Me´nard JF and Levy E. Localization and role of NPC1L1 in cholesterol absorption in human intestine. J. Lipid Res. 2006; 47: 2112–2120.
11. Turley SD. Role of Niemann-Pick C1–Like 1 (NPC1L1) in Intestinal Sterol Absorption. Journal of Clinical Lipidology 2008; 2: S20–S28.
12. Krawczak M., Ball EV, Fenton I, Stenson PD., Abeysinghe S, Thomas N. and Cooper DN. Human gene mutation database-a biomedical information and research resource. Hum. Mutat, 2000; 15: 45–51.
13. Schifreen RS, Storts DR & Buller AM. The Challenge of Using SNPs in the Understanding and Treatment of Disease. BioTechniques 2002; 32: S14-S21.
14. Dolores C and Jose MO. Single Nucleotide Polymorphisms that influence lipid metabolism: interaction with dietary factors. Annu. Rev. Nutr. 2005; 25:341–90.
15. Cheng J, Randall A, and Baldi P. Prediction of Protein Stability Changes for Single-Site Mutations Using Support Vector Machines. Proteins: Structure, Function, Bioinformatics, 2006; vol. 62, no. 4: 1125-1132.
16. Uzun A, Leslin C, Abyzov A, Ilyin V. Structure SNP (StSNP) Database: A tool for modeling nsSNPs locations on proteins and presenting their metabolic pathways. Nucleic Acid Research, 2007; 1–9.
17. Lahiri DK and Nurnberger JI. A rapid non-enzymatic method for the preparation of HMW DNA from blood for RFLP studies. Nucleic Acids Res. 1991; 19: 5444.
18. Allen RC, Graves GM and Budowle B. Polymerase chain reaction amplification products separated on rehydratable polyacrylamide gels and stained with silver. Biotechniques 1989; 7: 736-744.
19. Friedewald WT, Lavy RI & Fredrickson DS. Estimation of the concentration of low-density lipoprotein cholesterol in plasma, without use of preparative ultracentrifuge. Clin Chem 1972; 18: 499–502.
20. Vieux EF, Kwok Pui-Y, and Miller RD. Primer Design for PCR and Sequencing in High-Throughput Analysis of SNPs. BioTechniques 2002; 32: S28-S32.
21. He Q, Marjamaki M, Soini H, Mertsola J, and Viljanen MK. Primers are decisive for sensitivity of PCR. Biotechniques 1994; 17: 82-87.
22. Dieffenbach CW, Lowe TMJ, Dveksler GS. General Concepts for PCR Primer Design. In: PCR Primer, A Laboratory Manual, Dieffenbach CW, Dveksler GS Ed., Cold Spring Harbor Laboratory Press, New York, 1995; 133-155.
23. Abd-Elsalam KA. Bioinformatic tools and guideline for PCR primer design. African Journal of Biotechnology 2003; Vol. 2 (5):91-95.
24. Altschul SF, Gish W, Miller W, Myers EW & Lipman D J. Basic local alignment search tool. J. Mol. Biol. 1990; 215: 403-410.

Generated at: Thu, 24 May 2012 10:59:17 -0500 (0000081c) — http://www.ispub.com:80/journal/the-internet-journal-of-cardiovascular-research/volume-6-number-2/analysis-of-nssnp-rs1468384-of-npc1l1-and-its-association-with-plasma-cholesterol-levels-in-general-population.html