Genotyping S328F SNP of human ACAT2 among CVD patients and normal population from North Western India and its associated lipid profile
Abstract
Acyl-coenzyme A: cholesterol acyltransferase 2 (ACAT2, EC2.3.1.26) is an integral membrane protein located in the rough endoplasmic reticulum (ER). It maintains a balance between the availability of free and esterified cholesterol and is critically important for cell function. Purpose: The present study discusses the standardization of protocol to delineate the role of SNP S328F in ACAT2 gene. Methods: SNP S328F stability prediction was done using CUPSAT and various parameters like Primer concentration, amount of taq and glycerol etc were studied to set a protocol using Polymerase Chain reaction to achieve a product of 127 base pair. Restriction digestion was done overnight using BsmA1 enzyme to study the genotypes. The present study was used to study the SNP in 200 healthy subjects and 166 CAD patient group.Results: Higher frequency of C allele was observed in CAD patients and higher levels of TC were observed to be related to the presence of allele T which is associated with the presence of hydrophobic amino acid F at position 328. Discussion and Conclusion: Presence of T allele leads to more accumulation of cholesterol esters as it increases the protein stability in the cytoplasmic region and consequently making the individual more susceptible to atherosclerosis.
Introduction
Acyl-coenzyme A: cholesterol acyltransferase 2 (ACAT2, EC2.3.1.26) is an enzyme found both in the liver and in the intestine. It is responsible for the synthesis of cholesteryl esters from (LDLs and HDLs) cholesterol and (long chain) fatty acids either from our diets or internally, from the body [1]. The enzyme appears to modulate the potentially toxic effects of cholesterol in cell membranes, by attaching a fatty acid to the free hydroxyl group of cholesterol [2]. Unlike free (unesterified) cholesterol that partitions in the lipid bilayer, cholesteryl esters exist as oily lipid droplets in the cytosol, acting as a means for cholesterol storage [3]. A balance between the availability of free and esterified cholesterol is critically important for cell function [4]. The gene for the enzyme is localized on chromosome no. 6. Seven Single nucleotide polymorphisms (SNPs) have been listed at the locus out of which four are synonymous and three are non-synonymous. Nonsynonymous SNPs (nsSNPs) might directly or indirectly affect functionality of the protein, alone or by altering its interactions with other proteins in a multi-protein complex, thereby increasing/decreasing the activity [5]. This in turn may contribute to the etiology of genetic diseases or susceptibility to diseases [6].
Keeping in mind the importance of nonsynonymous SNPs, one such SNP S328F present in Gene ACAT2 (geneID: 39) linked via Contig Annotation; was selected from NCBI SNP database (http://www.ncbi.nlm.nih.gov/Entrez/). The variation at this site is a result of change from C to T at nucleotide position 19354. This nsSNP in exon 8 leads to change of hydrophilic neutral serine to hydrophobic Phenylalanine at position 328 (ref SNP ID: rs12213253). The present study aimed at in-silico prediction of the effect of above mentioned amino acid change on the stability of the protein in that specific region. Based on change in stability and its predicted functionality it was of interest to study the prevalence of this SNP in normal population as well as pathology samples, for which a novel PCR- RFLP methodology has been developed.
Material and Methods
SNP stability prediction
Change in amino acid at this position may change the structural stability of the protein which was analyzed using a web server CUPSAT (Cologne University Protein Stability Analysis Tool). This program uses structural environment specific atom potentials and torsion angle potentials to predict ΔΔG, the difference in free energy of unfolding between wild-type and mutant proteins [7]. Input was fed as available protein structure in Protein Data Bank ID 1WL4 (http.//www.ebi.ac.uk) and the location of the residue which is mutated. The output consisted of information about mutation site, its structural features (solvent accessibility, secondary structure and torsion angles), and comprehensive information about changes in protein stability.
Sample collection
Blood samples were collected from normal healthy population and patient group having CVD from Punjab with informed consent of people. 3 ml of blood sample was used to isolate Genomic DNA using the technique as followed by Sambrook et al. [8]. The project was cleared from institutional Ethics Committee on Biomedical Human research, Punjabi University, Patiala.
Standardization of PCR
The key to the PCR lies in the designing of the two oligonucleotide primers. Sequence of ACAT2 SNP F328S was retrieved from NCBI and primers were designed using GENE RUNNER version 3.05. Six pairs of primers were predicted (Table 2). Different combinations of primer pair concentration along with other components like taq, annealing temperature and DNTPs were used for standardization of reaction mixture used for amplification (Table 1).

Table 1: Reaction mixture used for PCR: Various combinations of primer pair with Taq and DNTPs concentrations in the following three protocols were investigated.
PCR programs were also standardized using different annealing temperatures 63°C to 60°C. Finally 60°C resulted in a single band of product without any spurious products and was used to further investigate samples.
After amplification PCR product was checked on 10% Polyacrylamide Gel and visualized using silver staining. Spurious bands of high molecular weight were obtained during the course of standardization procedure for ACAT2 amplification. Results obtained using different protocols mentioned above are shown in fig2.
RFLP analysis
Restriction Enzyme was searched from New England Biolab website, http.//www.neb.com/ following enzymes was found:
BsmA1 (cutting site GTCTC) was selected based upon the SNP recognition site and availability of the enzyme. Enzyme was procured from New England Biolabs. Protocol shown in table 3 was used for restriction digestion of 127bp product.
Table 3: Reaction mixture used for digestion of PCR product:
This reaction mixture was kept at 37° C for overnight digestion.
The data for prevalence of SNP S328F in different populations was retrieved from NCBI site (http://www.ncbi.nlm.nih.gov/SNP/snp). This data was compared with Punjabi population for its significance in this population.
Results And Discussion
SNP stability and structure: CUPSAT predicts the stability of protein mutants with accuracy in the range of 80–87% with a standard error of 0.78–1.15 kcal/mol. The amino acid change from SER to PHE at position 328 leads to the overall increased stability of the protein with favorable torsion angle and ΔΔG value of 0.55.
Based upon tm and GC% and secondary structure and structural features like Dimer formation, hairpin loop, bulge loop and internal loop formation in the primers, only one pair was selected as follows:
Forward primer- 5’GGTTGGTCACTGGAAGATGTTG3’ Tm-62.5
Reverse primer- 5’GCTCTCAGGGTTACTTGTGCATC3’Tm-63.9
Selected pair of primer was also checked for the gene specificity using NCBI BLAST tool. (http://www.ncbi.nlm.nih.gov/BLAST). The same primer pair was then checked for Insilco PCR using UCSC human genome browser (http://genome.ucsc.edu/cgi). A product of 127bp was also obtained with this. Following figures showed results obtained with different protocols:
RFLP analysis
Band pattern obtained after restriction digestion of 127 bp product is shown below.
Homozygous CC – 67bp, 60bp Heterozygous CT – 127bp, 67bp, 60bp Homozygous TT- 127 bp
The overnight digested product was checked on 10% PAGE and visualized by silver staining. Gel was run at 150V for 1hr 30min (fig. 3).
The amount of Taq polymerase was tested in the range 0.25 to 3 U per reaction. As little as 0.5 U of enzyme can be used without a decrease in the yield of PCR product (data not shown). PCR was performed at 25, 30, 35, and 40 cycles, including the initial cycle. Although PCR products can be detected after 25 cycles, maximal PCR product were obtained with 30 cycles of PCR amplification without the production of nonspecific PCR products (data not shown). Same amount of PCR product was obtained with higher no. of cycles. The range of template genomic DNA necessary to produce detectable PCR products was then investigated, from 25 to 200 ng of DNA. 25 ng of genomic DNA can be amplified without a significant reduction in the intensity of the signals (data not shown). 25pM - 60pM of primer concentration was investigated, spurious amplification was observed with higher concentration of primers. 30pM of primer concentration was found to be sufficient to obtain good amount of PCR product (fig.2). Digestion of PCR product was carried out by directly addition of enzyme digestion buffer, without a reduction in the efficiency of BsmA1digestion (fig. 3).
This methodology can be used for population screening or large number of patient samples within a short period. Given protocol has been standardized as to maximize the analytical power by obtaining product with lowest amounts of input. Improved efficiency and lower cost should be useful in a clinical diagnostic laboratory or a research laboratory performing population screening. As the allele studied has relevance to prediction of disease susceptibility and drug response, it has been analyzed in Indian North Western population as a test case. The developed protocol was used for SNP typing S328F in 200 normal healthy individuals from Punjab.

Table 4: Allele frequency of S328F among populations of the world (http://www.ncbi.nlm.nih.gov/SNP/snp)
As shown in table 2, higher frequency of C allele (0.65) than T (0.35) was observed in this population. Highly significant difference was observed in the allele frequency (p<0.0001) when compared with other populations of the world that show monomorphism at this locus as reported at NCBI (Table 5). The populations used for comparison with Punjabi population were of mixed origin from different regions of the world. European population consisted of Utah residents with ancestry from northern and western Europe. Asian population comprised of individuals from Beijing and China. The other Asian population was of Japanese origin from Tokyo in Japan. African population was from Ibadan and Nigeria. All these samples were analyzed for SNP distribution by sequencing. All of them were found to be homozygous at this locus whereas Punjabi population displayed heterozygosity. ACAT2 is found predominantly in the liver and intestine, the major site of ApoB-containing lipoprotein assemble and secretion [910]. As studied by Joyce et al [11] cholesterol esters formed in the lumen may be readily used by apoB and microsomal triglyceride transfer protein for lipoprotein particle assembly, whereas proteins in the cytosol associated with lipid droplet formation may target cholesterol esters for storage. Since the T allele increases protein stability in the cytoplasmic region of the protein which probably increases the binding of cholesterol for conversion to cholesterol esters and its consequent accumulation into lipid droplets and increasing the tendency for lipid storage instead of lipid metabolism and transport. Its presence in the population may have implications for disease susceptibility specially influencing accumulation of cytosolic cholesterol droplets.
In literature two ACAT2 models have been proposed. Joyce et al [11] determined that the Ser249 of ACAT2 resides in the active site by studying the mutations of the residue which leads to inactivation of the enzyme. They predicted presence of five transmembrane domains. They further localized the Ser249 to putative ER lumen by observing glycosilation and accessibility to proteases of microsomal membranes. The SNP S328F apparently lies near to the active site and may be a part of the triad of amino acids Ser-His-Asp residues in the active site as catalytic triad present in enzymes that bind cholesterol substrate like serine esterase, ACAT and LCAT
Song et al [12] proposed another model for ACAT2 which contains only two detectable transmembrane structure near N terminal region. They inserted two different antigenic tags (hemagglutinin, monoclonal antibody Mab1) at various hydrophilic regions flanking each of its predicted TMDs, and expressed the recombinant proteins in mutant Chinese hamster ovary cells lacking endogenous ACAT. The existence of these two TMDs has been predicted by the PhD algorithm and the TMpred algorithm. They identified the histidine residues frequently involved in the enzymatic catalysis due to reactive immodazolium nitrogen, which function as a hydrogen bond donor/ acceptor. Conserved histidine and serine residues are essential for ACAT2 activity Histidine and serine residues were identified by studying sites specific mutagenesis, and then expressing the mutants individually in AC29 cells by transient transfection. They found that H434 plays a significant role in ACAT catalysis due to its presence in hydrophobic region.
Sojin et al [12] further based on their site directed mutagenesis studies proposed that H360 and H399 are critical residues involved in ACAT catalysis. H360 and H399 are located in the cytoplasm side of the ER and explained why catalysis takes place in the cytoplasm or near the cytoplasm side of the membrane. Mutated H399A in ACAT2 causes complete loss of enzyme activity. The presence of SNP C328T i.e. S328F near the active sites S249 and H360 has potential to influence the structural stability of the region and consequently the activity of the enzyme. C allele leads to presence of ser328 and T allele by its replacement with Phe328. The phe328 is found to stabilize the structure in the region (as per CUPSAT) and is found to be present at a frequency of 0.35 as compared to ser328 at 0.65. Presence of T allele may have implications for susceptibility to atherosclerosis in this population. Further study of patient group was undertaken to discern the effect of this prediction.
As we found that the SNP could affect the disease susceptibility a study was carried out in a group of random unrelated patients having CVD. Total 166 samples were analyzed for occurrence of different alleles. Highly significant difference (p= < 0.0001) was observed in the individuals having CAD from normal individuals (Table 6).
HDL levels among different genotypes were not found to be significantly (p- 0.08) different from each other (Table No. 7) LDL levels were also not found to be significantly related to occurrence of different alleles. Total Cholesterol levels were found to be associated with higher frequency of T allele. Higher levels TC were associated with the presence of F328 in the population (Table No.7). The risk ratio was found to be 1.4 times higher in individuals with T allele. The presence of aromatic hydrophobic amino acid Phenylalanine in place of hydrophilic neutral serine residue leads to more accumulation of cholesterol esters as it increases the protein stability in the cytoplasmic region and consequently making the individual more susceptible to atherosclerosis. This study can be of fundamental importance to study the pharmacokinetics in relation to SNPs and to design specific inhibitors for ACAT2 to prevention of cardiovascular disease.
Web links
http://www.ncbi.nlm.nih.gov/Entrez/
http://glinka.bio.neu.edu/StSNP/
Correspondence to
Dr. Praveen P. Balgir Department of biotechnology Punjabi university, Patiala-147 002 Phone no. – 09872886277 Email- balgirbt@yahoo.com









