Advertisement
Advertisement

The Internet Journal of Infectious Diseases ISSN: 1528-8366


Analysis Of PCR Products From Using Emm Primers For Different Streptococcus Pyogenes Strains


Viroj Wiwanitkit M.D. Department of Laboratory Medicine, Faculty of Medicine, Chulalongkorn University

Citation:  V. Wiwanitkit: Analysis Of PCR Products From Using Emm Primers For Different Streptococcus Pyogenes Strains. The Internet Journal of Infectious Diseases. 2005 Volume 4 Number 2

Keywords:  PCR, emm, Streptococcus pyogenes

Abstract

Streptococcus pyogenes is a small bacterium causing problematic infectious diseases. S. pyogenes expresses important virulence factors like the antiphagocytic M protein, the complement factor-inactivating C5a peptidase and the immunoglobulin-Fc-binding proteins on its surface. The corresponding emm and emm-related (fcrA, ennX) genes are adjacently encoded on the genome. The characterization of emm from the S. pyogenes revealed some discrepancies with serotyping, illustrating the difficulty in serotype determination when cross-reactions occur. Here, the author performed an analysis of PCR products from using emm primers for different Streptococcus pyogenes strains. Based on the PCR amplification, the electronic analysis of the PCR product for each S. pyogenes strain was identified. The reported sequence might be used in further development of molecular-based diagnostic tools.


Introduction

Streptococcus pyogenes (or group A beta hemolytic streptococcus) is a small bacterium causing problematic infectious diseases [1]. It is a pathogenic bacterium that can give rise to a range of invasive and autoimmune diseases, although it is more widely known as the cause of tonsillitis [1]. Resistance to erythromycin and lincomycin by S. pyogenes has been noted for many years and becomes an important problem in infectious medicine [2]. A significant increase in erythromycin resistance was observed with clinical S. pyogenes [3].

S. pyogenes expresses important virulence factors like the antiphagocytic M protein, the complement factor-inactivating C5a peptidase and the immunoglobulin-Fc-binding proteins on its surface [4]. The corresponding emm and emm-related (fcrA, ennX) genes are adjacently encoded on the genome [4]. Podbielski et al. first applied the polymerase chain reaction (PCR) to study the M protein gene family in beta-hemolytic streptococci in 1991 [5]. Musser et al noted that the occurrence of the same emm alleles in strains that are well differentiated in overall chromosomal character demonstrates that horizontal transfer and recombination play a fundamental role in diversifying natural populations of S. pyogenes [6]. Relf et al.noted that characterization of emm from S. pyogenes revealed some discrepancies with serotyping, illustrating the difficulty in serotype determination when cross-reactions occur [7]. Here, the author performed an analysis of PCR products from using emm primers for different Streptococcus pyogenes strains.

Materials and Methods

Emm primers and studied S. pyogenes strain

The emm primers used in this study are quoted from those developed by Pimtanothai et al [8]. The primers are 5'TATTCCCTTAGAAAATTAA and 5' GCAAGTTCTTCAGCTTGTTT, respectively. There are 5 observed S. pyogenes strains in this study. The studied strains include M1 GAS, MGAS8232, MGAS315, SSI-1 and MGAS10394.

PCR amplification testing and sequencing of the PCR product

The PCR amplification was performed using the standard protocols proposed by Pimtanothai et al.[8]. The new electronic tool by Bikandi et al. [9] was used for amplification and sequencing of the PCR products Briefly, this tool allows getting the PCR results for a regular PCR amplification [8]. Resulting page will show an electronic list of amplified bands and a DNA electrophoresis of the bands [9]. DNA sequence of each band and the identity of amplified genes are automatically available on the resulting page [9].

Results

According to the PCR amplification, the electronic analysis of the PCR product for each S. pyogenes strain is shown in Table 1.


                  
          Table 1: Sequences of the bands from amplification for each Streptococcus pyogenes strain.

Table 1: Sequences of the bands from amplification for each Streptococcus pyogenes strain.

Discussion

In choosing the appropriate antimicrobial therapy, one must take into account the resistance profile of the target pathogen, the agent's antibacterial profile and the intrinsic activity against the target pathogen [10]. Cunningham noted that emm gene sequencing had changed serotyping, and new virulence genes and new virulence regulatory networks have been defined [11]. Cunningham also noted that the emm gene superfamily had expanded to include antiphagocytic molecules and immunoglobulin-binding proteins with common structural features [11].

During recent years, various new techniques have been adapted for the diagnosis of S. pyogenes infection, notably in the field of molecular biology and standard PCR is currently the method of choice for emm typing. In this study, the author analyzed the PCR products from using emm primers for five different Streptococcus pyogenes strains based on a new electronic tool. Findings from the electronic analysis of the product revealed that a specific produce for each strain can be separated. Of interest, these sequences have never been noted before. Here, the sequences of the detected products are also analyzed and presented. The reported sequence might be used in further development of molecular-based diagnostic tools.

References

1. Dale RC. Streptococcus pyogenes and the brain: living with the enemy. Rev Neurol 2003;37:92-7
2. Sanders E, Foster MT, Scott D. Group A beta-hemolytic streptococci resistant to erythromycin and lincomycin. N Engl J Med 1968;278:538-40
3. Szczypa K, Sadowy E, Izdebski R, Hryniewicz W. A rapid increase in macrolide resistance in Streptococcus pyogenes isolated in Poland during 1996-2002. J Antimicrob Chemother 2004;54:828-31
4. Podbielski A, Kaufhold A, Lutticken R. The vir-regulon of Streptococcus pyogenes: coordinate expression of important virulence factors. Immun Infekt 1992;20:161-8
5. Podbielski A, Melzer B, Lutticken R. Application of the polymerase chain reaction to study the M protein(-like) gene family in beta-hemolytic streptococci. Med Microbiol Immunol (Berl) 1991;180:213-27
6. Musser JM, Kapur V, Szeto J, Pan X, Swanson DS, Martin DR. Genetic diversity and relationships among Streptococcus pyogenes strains expressing serotype M1 protein: recent intercontinental spread of a subclone causing episodes of invasive disease. Infect Immun 1995;63:994-1003
7. Relf WA, Martin DR, Sriprakash KS. Antigenic diversity within a family of M proteins from group A streptococci: evidence for the role of frameshift and compensatory mutations. Gene 1994;144:25-30
8. Pimtanothai N, Orataiwun P, Nilgate S, Suankatay C, Nunthapisud P. Emm types of invasive group A streptococcal isolates from Thai patients at King Chulalongkorn Memorial Hospital from 1995-1999. J Med Assoc Thai 2002;85 Suppl 1:S371-7
9. Bikandi J, San Millán R, Rementeria A, Garaizar J. In silico analysis of complete bacterial genomes: PCR, AFLP-PCR, and endonuclease restriction. Bioinformatics 2004;20:798-9
10. Hedrick J. Acute bacterial skin infections in pediatric medicine: current issues in presentation and treatment. Paediatr Drugs 2003;5 Suppl 1:35-46
11. Cunningham MW. Pathogenesis of group A streptococcal infections. Clin Microbiol Rev 2000;13:470-511

Generated at: Fri, 10 Feb 2012 04:33:08 -0600 (00002290) — http://www.ispub.com:80/journal/the-internet-journal-of-infectious-diseases/volume-4-number-2/analysis-of-pcr-products-from-using-emm-primers-for-different-streptococcus-pyogenes-strains.html