The Internet Journal of Microbiology™ ISSN: 1937-8289

| Home | Editors | Current Issue | Archives | Instructions for Authors | Disclaimer | Bookmark and Share Share with others |
 

Isolation of medically important fungi from Ginkgo biloba leaves and crude Ginkgo supplements

Ruhul H. Kuddus PhD
Assistant Professor
Department of Biology, Utah Valley University, Orem, UT Physical Address

Jonathan Oakes B.S.
Research Associate
Department of Biology, Utah Valley University, Orem, UT Physical Address

Casey L. Sharp B.S.
Undergraduate Researcher
Department of Biology, Utah Valley University, Orem, UT Physical Address

Joel Scott B.S.
Undergraduate Researcher
Department of Biology, Utah Valley University, Orem, UT Physical Address

Ken Slater B.S.
Laboratory Manager
Department of Biology, Utah Valley University, Orem, UT Physical Address

Jorma J. Kirsi PhD
Professor
Department of Biology, Utah Valley University, Orem, UT Physical Address

Olga R. Kopp Ph.D.
Assistant Professor
Department of Biology, Utah Valley University, Orem, UT Physical Address

Wayne R. Burt PhD
Director
Western Research Laboratory, Salt Lake City, UT Physical Address

Citation: R. Kuddus, J. Oakes, C. Sharp, J. Scott, K. Slater, J. Kirsi, O. Kopp & W. Burt : Isolation of medically important fungi from Ginkgo biloba leaves and crude Ginkgo supplements. The Internet Journal of Microbiology. 2009 Volume 7 Number 1


Keywords: Ginkgo biloba | complementary and alternative medicine (CAM) | microbial contamination | Ginkgo tea

 

Abstract

We observed fungal growth in Ginkgo biloba leaves in the middle of the growth season and isolated Phoma sp. and Curvularia sp. from the affected leaves. We also isolated Aspergillus sp. and Curvularia sp. from brown spots of apparently healthy leaves; Aspergillus sp., Chaetomium sp., Fusarium sp., Penicillium sp. and Aureobasidium sp. from tissue explants from brown spots of Ginkgo tea flakes (from three different suppliers); and Chaetomiumsp., Penicilliumsp., Aspergillus sp. and Aureobasidium pullulans from cold-brewed Ginkgo flake tea (from one supplier). Fungus was not recovered from any of the eight samples of hot-brewed (at 75°C or 90°C for 5 minutes) Ginkgo tea tested, cold- or hot-brewed powdered Ginkgo tea (from two suppliers) and three different brands of Ginkgo tea bags. This data indicated that G. biloba leaves and crude supplements derived from crushed Ginkgo leaves could be contaminated by fungi known to be opportunistic pathogens.



Introduction

Ginkgo biloba is among the most ancient surviving trees. The tree is remarkably resistant to microbial infections (Major, 1967; Huang et al., 2000; Mazzanti et al., 2000). While examining genetic diversity of Ginkgo trees introduced to the United States (Kuddus et al., 2002) we observed fungal growth in prematurely dying leaves of some adult Ginkgo trees. We also observed brown spots and mildew-like growth in the leaves of Ginkgo trees (all in the middle of Gingko growth season) and isolated fungi from the affected tissues.

Various G. biloba preparations are used in complementary and alternative medicines (CAM) as well as (experimental) conventional medicine (reviewed in DeFeudis, 1998; Sierpina et al., 2003; Kuddus, 2005; Carlson et al., 2007). Ginkgo products come as crude preparations such as Ginkgo tea and capsules or in the form of pharmacologically standardized extracts. Crude supplements such as Ginkgo tea are made simply by crushing dried Ginkgo leaves. Thus microbes (and their toxins) present in leaf tissues may also be present in the supplements. Since G. biloba is known to be highly resistant to microbial infections, infection or intoxication risks from consumption of G. biloba supplements could be underestimated. Use of CAM has increased significantly and G. biloba preparations are among the highest selling CAM (Eisenberg et al., 1998; Jones, 2007). Here we describe isolation of fungi, including some known opportunistic pathogens, from both live and prematurely dying G. biloba leaves and crude G. biloba supplements.

Materials and methods

Field work

Two urban G. biloba populations, one located at Pittsburgh, Pennsylvania (Lat 40° 21' N, Long 79° 55' W, Alt 382 meter) and another at Orem, Utah (Lat 40° 17' N, Long 111° 41' W, Alt 1448 m) were observed year-round for about two years (June 2003 to May 2006). G. biloba leaves emerge in February-March and become senescent by late October to early November in both regions. Trees with excessive numbers of prematurely dry leaves before August and green leaves with visible fungal growth (before September) were collected and inspected by stereomicroscope. Loose Ginkgo tea flakes (from three suppliers), loose powdered tea (from two suppliers) and individually bagged Ginkgo tea (three brands) were purchased from local health food stores (between June 2005 and June 2007).

Tissue Staining for In Situ Detection and isolation of fungi

Affected leaves, tea flakes and healthy leaves (as control) were cleared of superficial microbes by boiling in 2.5% KOH. The treated leaves were stained with trypan blue and counter-stained with Sudan IV to detect intercellular fungi as described previously (Barrow and Aaltonen, 2004). The treated samples were examined using a Labomed CXR3 microscope at 400-1,000x magnification and photographed. At least 20 fields were examined for each leaf sample.

To isolate fungi, leaves or tea flakes were initially cleaned using sodium hypochlorite, distilled water and ethyl alcohol as described by Tuite (1969). Tissue explants were harvested aseptically under a dissection microscope and then placed on potato dextrose agar (PDA) plates. Fungi in brewed loose Ginkgo tea were examined as described previously (Halt, 1998; Wilson et al., 2004). Pre-packed tea bags were brewed in hot (rolling-boiled) distilled water in sterilized cups following standard brewing methods (Rombauer et al., 2006). Tea was steeped for 2-3 minutes and the brew was serially diluted with sterile water and 0.1 ml was plated in two PDA plates. Similarly treated sterile distilled or tap water was plated as the controls. The plates were incubated at room temperature for 4-10 days. All experiments were done at least twice. Fungal (and bacterial) colonies were counted as colony forming units (cfu)/gm of tea using the formula- (number of colonies multiplied by dilution factor multiplied by total volume of water used in brewing)/grams of tea used.

Identification of Fungi

Fungal hyphae were transferred to new plates to establish pure culture and then identified to the level of genera using conventional methods (data not shown). Phoma sp. and Curvularia sp. were identified to species level by cloning and sequencing 18S rDNA. DNA was extracted from hyphae using cetyltrimethylammonium bromide extraction method as described (Carlson et al., 1991). Crude DNA was further cleaned using GenElute Plant Genomic DNA Miniprep DNA kit (Sigma, Saint Louis, MO). A ~900bp fragment of 18S rDNA was PCR-amplified using primers (5'GCAAGTCTGGTGCCAGCAGCC3' and 5'GCATCACACCTGTTATTGCCCT3') as described previously (White et al., 1990). The amplified PCR products were resolved in 1% agarose gel (data not shown), gel-purified using QIAquick Gel Extraction kit (Qiagen, Santa Clarita, CA) and cloned in pCR4-TOPO cloning vector (Invitrogen, Carlsbad, CA). DNA extracted from at least three independent transformed bacterial colonies harboring the recombinant pCR4-TOPO plasmids (carrying fungal rDNA inserts) was sequenced from both ends of the inserts using an external vendor (Gene Gateway, Hayward, CA). The electropherograms of the sequencing reactions were studied carefully using Chromas software (http://www.technelysium.com.au/). The DNA sequences were analyzed using BLAST (http://www.ncbi.nlm.nih.gov/) and MultAlin software (http://bioinfo.genopole-toulouse.prd.fr/multalin/). Bacteria (mostly Bacillus sp.), non-sporulating coenocytic fungi and yeasts that grew from some samples were not identified.

Results

Several adult trees (about 20 meters in height) in Pittsburgh were found with drying leaves in June and July (midway of the growth season). The affected female trees had green seeds yet the plants were attempting to sprout new buds (Fig. 1A). Normally G. biloba sprouts buds only once and very early (March-April) in the growth season. Leaf samples were isolated from three different affected trees for further examination. In August of the same year, a young G. biloba tree (about two meters in height) was found at Orem, Utah having green leaves with drying margins and mildew-like growth in the green tissues (Fig. 1B). Stereomicroscopic examination of the leaves confirmed fungal growth in the leaves of the affected trees from both locations (Fig. 1A, inset). Endophyte staining also revealed the presence of fungi in the tissue of the affected leaves (Fig. 1C). When aseptically removed tissue explants from the affected leaves were placed on PDA plates, fungi grew profusely (data not shown). Fungus grown from leaves of the affected trees from Pennsylvania was identified as Phoma sp. (data not shown). The sequence of an 888 bp fragment of 18S rDNA cloned from this sample (GenBank Accession Number EF152573) was identical to the 18S rDNA sequence of P. herbarum. Fungus grown from the affected leaves of tree from Utah was identified as Curvularia sp. (data not shown) and the sequence of an 887bp fragment of 18S rDNA cloned from this sample (GenBank Accession Number EF152574) was >95% similar to the 18S rDNA sequence of C.brachyspora. In the following growing season, the affected trees at Pittsburg recovered and produced leaves and cones but the affected young tree at Orem attempted to recover but died by the month of June, the middle of the growth season (data not shown).

Thumbnail: Fig. 1. Presence of fungi in G. biloba leaves and tea flakes. A. Photograph showing twigs of an affected tree (top) and an unaf...
Fig. 1. Presence of fungi in G. biloba leaves and tea flakes. A. Photograph showing twigs of an affected tree (top) and an unaffected tree (bottom) from Pittsburgh, PA. Note the presence of dry leaves and wilted seeds along with (newly sprouted) young leaves in the affected twig (indicated by an arrow). Stereomicroscopic image (x4) of an affected leaf is shown in the inset. B. Photograph showing twig of an affected tree from Orem, UT (mildew-like growth on leaves is indicated by an arrow). C. Fungal hyphae in the tissue of an affected leaf of a tree from Pittsburgh, PA (x1,000). D. A brown spot in a healthy G. biloba leaf (x40). E. A brown spot in a Gingko tea flake (x40). F. A tea flake stained for endophytes and examined microscopically. Fungal hyphae growing in and around stomata are visible (x400).

We observed the presence of brown spots in many healthy adult green leaves of every G. biloba tree we examined in July and August (Fig. 1D and data not shown) in both locations. Similar spots were also present in some Ginkgo tea flakes (Fig. 1E). Endophyte staining revealed the presence of fungal hyphae in the tea flakes (Fig. 1F and data not shown). Fungi grew out when aseptically removed tissue explants from the brown spots of live leaves or tea flakes were placed on PDA plates (data not shown). Fungi recovered from brown spots of live G. biloba trees were identified as Aspergillus sp. and Curvularia sp. All three flake tea samples examined were positive for fungal growth (from tissue explants). The fungi were identified as Aspergillus sp., Chaetomium sp., Fusarium sp. and Penicillium sp.

To test if microbes are present in the brewed Ginkgo tea, cold- and hot-brewed tea samples were plated in PDA plates. Fungi grew out from cold-brewed tea derived from one of the three flake tea samples and the fungal load was estimated to 8,000 fungal cfu/gm of tea. All water controls for cold brewing experiments were negative for fungal growth. The sporulating fungi were identified as Chaetomiumsp., Penicilliumsp. Aspergillus sp. and Aureobasidium pullulans. No fungus was recovered from hot-brewed loose flake tea, cold or hot-brewed loose powdered tea or bagged tea samples.

Discussion

Although G. biloba is remarkably resistant to microbial colonization (Major, 1967; Huang et al., 2000), fungal colonization of young G. biloba trees appears to be common because fungicides are routinely used in the agro-industrial propagation of Ginkgo (DeFeudis, 1998). Previous reports indicated that several fungi (such as Glomerella cingulata, Phyllosticta ginkgo, and Epicoccum purpurascens) may colonize live G. biloba leaves (Hepting, 1971; Hartman et al., 2000). It is possible that the fungi simply occupied (colonized) tissues of environmentally stressed leaves or existing brown spots of the leaves of live trees without causing a primary infection. Whether any of the fungi we isolated are primary pathogens of Ginkgo trees remained to be investigated. However, if the fungi could survive in the leaf tissues, the microbes and their metabolites (mycotoxins) could pass on to the crude CAM derived from such leaves (Rader et al., 2007).

We observed that brown spots are common in adult healthy Ginkgo leaves particularly during the later half (August-September) of the growing season. Brown spots were also common in Ginkgo tea flakes sold in health food stores. We isolated several species of fungi from aseptically explanted tissues of such brown spots and cold-brewed Ginkgo tea derived from one of the three flake tea brands tested. Cold-brewed teas from two other samples were negative for fungal growth although staining showed presence of fungus in both of the tea flake samples. No fungi grew from hot-brewed tea. This data indicated that the colonizing fungi are not readily released by the standard brewing conditions.

We noticed that bacteria (and occasionally yeast) grew from both cold and hot-brewed tea derived from all three flake Ginkgo tea samples and two of the three bagged ginkgo tea samples with bacterial count ranging 100-1,100,000 bacterial cfu/gm of tea (data not shown). No bacterial growth was observed in cold or hot brewed tea derived from the powdered loose Ginkgo tea and one of the three brands of bagged ginkgo tea (data not shown). Wilson et al. (2004) reported the presence of bacteria at 10-1,600,000 cfu/100 ml of herbal tea brewed for 5 minutes at 90°C. Bacteria we isolated were mostly spore formers (Bacillus sp.). An investigation of bacterial contamination and presence of myctoxins in Ginkgo products is currently being planned. Bacterial contamination of CAM is quite common and considered a significant health hazard (Bouakline et al., 2000; Kneifel et al., 2000; Raman et al., 2004; Wilson et al., 2004; Tournas et al., 2006).

All of the fungal genera we isolated from live G. biloba leaves and supplements have been previously reported to cause (fatal) mycoses (Everett et al., 2003; Tessari et al., 2003; Teixeira et al., 2003; Varghese et al., 2004; Mohammedi et al., 2005; Petit et al., 2005). Microbial contamination of CAM could be an infection risk to immunocompromised populations (Halt, 1998; Bouakline et al., 2000; Kneifel et al., 2000; Wilson et al., 2004) given that people with poor health are among the major consumers of CAM (Austin, 1998; Upchurch and Chyu, 2005). Manufacturing of microbe-free Ginkgo supplements is possible as three of the Ginkgo tea brands we examined were found free of viable microbes (although not shown on the labels, it is possible that some of the tea samples were treated with antimicrobial agents). Dry herbs can be radio-sterilized without significant loss of active ingredients (Crawford and Ruff, 1996; Murcia et al., 2004). With the rapid increase in the use of CAM, appropriate quality control, some oversight and public education could be helpful in protecting the consumers and safeguard the industries.

Acknowledgements

This work was supported in part by UVU Presidential and Foundation grants to RHK. The authors are grateful to Drs. S. Rushforth, R. Van Buren, M. Bracken, and R. Robbins for helpful discussions and Dr. B. Bargeron for help with photography.

References

Austin J.A. 1998. Why patients use alternative medicine, JAMA, 279(19): 1549-1553. (s)

Barrow J.R. and Aaltonen R.E. 2004. Evaluation of the internal colonization of Atriplex canescens (Pursh) Nutt. roots by dark septate fungi and the influence of host physiological activity. Mycorrhiza, 11(4): 199-205. (s)

Bouakline A., Lacroix, C. Roux, N., Gangneux, J.P., and F. Derouin, F. 2000. Fungal contamination of food in hematology units. J. Clin. Microbiol. 38(11): 4272-4273. (s)

Carlson, J.E., Tulsieram, LK., Glaubitz, J.C., Luk, V.W.K., Kauffeldt, C., and Rutledge, R. 1991. Segregation of random amplified polymorphic DNA markers in F1 progeny of conifers. Theor. Appl. Genet. 83(2):194-200. (s)

Carlson, J.J., Farquhar, J.W., DiNucci, E., Ausserer, L., Zehnder, J., Miller, D., Berra, K., Hagerty, L., and Haskell, W.L. 2007. Safety and efficacy of a ginkgo biloba-containing dietary supplement on cognitive function, quality of life, and platelet function in healthy, cognitively intact older adults. J. Am. Diet. Assoc. 107(3):422-432. (s)

Crawford, L.M., and Ruff, E.H. 1996. A review of the safety of cold pasteurization through irradiation. Food Control, 7(2): 87-97 (s)

DeFeudis, F.V. 1998. Ginkgo biloba extract EGB 761. Ullstein Medical, Wiesbaden, Germany. (s)

Eisenberg, D.M., Davis, R.B., Ettner, S.L., Appel, S., Wilkey, S., Van Rompay, M., and Kessler, R.C. 1998. Trends in alternative medicine use in the United States, 1990-1997: results of a follow-up national survey. JAMA, 280(18):1569-1575. (s)

Everett, J.E., Busick, N.P., Sielaff, T., Wahoff, D.C., and Dunn, D.L. 2003. A deeply invasive Phoma species infection in a renal transplant recipient. Transplant. Proc. 35(4): 1387-1389. (s)

Halt, M. 1998. Moulds and mycotoxins in herb tea and medicinal plants. Eur. J. Epidemiol. 14(3): 269-274. (s)

Hartman, J.R., Pirone, T.P., and Sall, M.A. 2000. Pirone’s Tree Maintenance. Oxford University Press, New York, NY. (s)

Hepting, G.H. 1971. Disease of Forest and Shade Trees of the US. USDA Forest Services Agriculture Handbook Number 386, US Government Printing Office, Washington DC. (s)

Huang, X., Xie, W., and Gong, Z. 2000. Characteristics and antifungal activity of a chitin binding protein from Ginkgo biloba. FEBS Lett. 478(1-2):123-126. (s)

Jones, A.A. 2007. Age related macular degeneration--should your patients be taking additional supplements? Aust. Fam. Physician. 36(12):1026-1028. (s)

Kneifel, W., Czech, E., and Kopp, B. 2000. Microbial contamination of medicinal plants-a review. Planta Med. 68(1): 5-15. (s)

Kuddus, R. 2005. Ginkgo biloba Medications: Prospects and Some Supplemental Problems. J. Utah Acad. Sci., 82(1):41-50. (s)

Kuddus, R.H., Kuddus, N.N. and Dvorchik, I. 2002. DNA polymorphism in the living fossil Ginkgo biloba from the eastern United States. Genome, 45(1): 8-12. (s)

Major, R.T. 1967. The Ginkgo, the most ancient living tree. Science, 157(794): 1270-1273. (s)

Mazzanti, G., Mascellino, M.T., Battinelli, L., Coluccia, D., Manganaro, M., and Saso, L. 2000. Antimicrobial investigation of semipurified fractions of Ginkgo biloba leaves. J. Ethnopharmacol. 71(1-2): 83-88. (s)

Mohammedi, I., Eckert, A., Thiebaut, A., Piens, M.A., Malhiere, S., and Robert, D. 2005. Fatal Aspergillus nidulans pneumonia. Rev. Med. Interne. 26(3): 249-250. (s)

Murcia M.A., Egea, I., Romojaro, F., Parras, P., Jiménez, A.M., and Martínez-Tomé, M. 2004. Antioxidant evaluation in dessert spices compared with common food additives. Influence of irradiation procedure. J. Agric. Food Chem. 52(7):1872-1881. (s)

Petit, A., Tabone, M.D., Moissenet, D., Auvrignon, A., Landman-Parker, J., Boccon-Gibod, L., and Leverger, G. 2005. Disseminated fusarium infection in two neutropenic children. Arch. Pediatr. 12(7): 1116-1119. (s)

Rader J.I., Delmonte, P., and Trucksess, M.W. 2007. Recent studies on selected botanical dietary supplement ingredients. Anal. Bioanal. Chem. 389(1):27-35. (s)

Raman, P., Patino, L.C., and Nair, M.G. 2004. Evaluation of metal and microbial contamination in botanical supplements. J. Agric. Food Chem. 52(26):7822-7827. (s)

Rombauer, I.S., Becker, M.R., and Becker, E. 2006. Joy of Cooking. Simons and Schuster, London. (s)

Sierpina, V.S., Wollschlaeger, B., and Blumenthal, M. 2003. Ginkgo biloba. Am. Fam. Physician, 68(5): 923-926. (s)

Teixeira, A.B., Trabasso, P., Moretti-Branchini, M.L., Aoki, F.H., Vigorito, A.C., Miyaji, M., Mikami, Y., Takada, M. and Schreiber, A.Z. 2003. Phaeohyphomycosis caused by Chaetomium globosum in an allogeneic bone marrow transplant recipient. Mycopathologia, 156(4): 309-312. (s)

Tessari, G., Forni, A., Ferretto, R., Solbiati, M., Faggian, G., Mazzucco, A., and Barba, A. 2003. Lethal systemic dissemination from a cutaneous infection due to Curvularia lunata in a heart transplant recipient. J. Eur. Acad. Dermato. Venereol. 17(4): 440-442. (s)

Tournas, V.H., Katsoudas, E., and Miracco, E.J. 2006. Moulds, yeasts and aerobic plate counts in ginseng supplements. Int. J. Food Microbiol., 108(2):178-181. (s)

Tuite, J. 1969. Plant pathological Methods. Burgess Publishing, Minneapolis. (s)

Upchurch, D.M., and Chyu, L. 2005. Use of complementary and alternative medicine among American women. Women Health Iss.15(1): 5-13. (s)

Varghese, G.M., Pise, G., Michael, S.J., Jacob, M. and George, R. 2004. Disseminated Penicillium marneffei infection in a human immunodeficiency virus-infected individual. J. Postgrad. Med. 50(3): 235-236. (s)

White, T.J., Bruns, T., Lee, S. and Taylor, J. 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In PCR Protocols: A Guide to Methods and Applications, Edited by Gelfand, D.H., J.J. Sninsky, and T.J. White, Academic Press, New York, pp:315-321. (s)

Wilson, C., Dettenkofer, M., Jonas, D., and Daschner, F.D. 2004. Pathogen growth in herbal teas used in clinical settings: a possible source of nosocomial infection? Am. J. Infect. Control. 32(2): 117-119. (s)


This article was last modified on Thu, 22 Oct 09 13:50:15 -0500

This page was generated on Sat, 20 Mar 10 23:19:57 -0500, and may be cached.

Advertisement